pLKO1PURO 慢病毒报装Protocols.docx

1、pLKO1PURO 慢病毒报装ProtocolsProtocols pLKO.1 ProtocolAddgeneis a global, non-profit plasmid repository dedicated to making it easier for scientists to share.pLKO.1 TRCCloning VectorAddgene Plasmid 10878. Protocol Version 1.0. December 2006.Copyright Addgene 2006, All Rights Reserved. This protocol is pr

2、ovided for your convenience. See “warranty information” in appendix.Table of ContentsA. pLKO.1-TRCCloning VectorA.1 The RNAi ConsortiumA.2 Map of pLKO.1A.3 Related plasmidsB. Designing shRNA Oligos for pLKO.1B.1 Determine the optimal 21-mer targets in your geneB.2 Order oligos compatible with pLKO.1

3、C. Cloning shRNA oligos into pLKO.1C.1 Recommended materialsC.2 Annealing oligosC.3 Digesting pLKO.1 TRC-Cloning VectorC.4 Ligating and transforming into bacteriaD. Screening for InsertsD.1 Recommended materialsD.2 Screening for insertsE. Producing Lentiviral ParticlesE.1 Recommended materialsE.2 Pr

4、otocol for producing lentiviral particlesF. Infecting Target CellsF.1 Recommended materialsF.2 Determining the optimal puromycin concentrationF.3 Protocol for lentiviral infection and selectionG. SafetyH. ReferencesH.1 Published articlesH.2 Web resourcesI. AppendixI.1 Sequence of pLKO.1 TRC-Cloning

5、VectorI.2 RecipesI.3 Warranty informationBack to TopA. pLKO.1-TRCCloning VectorA.1 TheRNAi ConsortiumThe pLKO.1 cloning vector is the backbone upon whichThe RNAi Consortiumhas built a library of shRNAs directed against 15,000 human and 15,000 mouse genes. Addgene is working with theTRCto make this s

6、hRNA cloning vector available to the scientific community. Please cite Moffat et al., Cell 2006 Mar; 124(6):1283-98 (PubMed”:http:/www.ncbi.nlm.nih.gov/pubmed/16564017?dopt=abstract) in all publications arising from the use of this vector.A.2 Map of pLKO.1pLKO.1 is a replication-incompetent lentivir

7、al vector chosen by theTRCfor expression of shRNAs. pLKO.1 can be introduced into cells via direct transfection, or can be converted into lentiviral particles for subsequent infection of a target cell line. Once introduced, the puromycin resistance marker encoded in pLKO.1 allows for convenient stab

8、le selection.Figure 1 : Map of pLKO.1 containing an shRNA insert. The original pLKO.1-TRCcloning vector has a 1.9kb stuffer that is released by digestion with AgeI and EcoRI. shRNAoligos are cloned into the AgeI and EcoRI sites in place of the stuffer. The AgeI site is destroyed in most cases (depen

9、ding on the target sequence), while the EcoRI site is preserved. For a complete map of pLKO.1 containing the 1.9kb stuffer, visitwww.addgene.org/10878.DescriptionVector ElementU6Human U6 promoter drivesRNAPolymeraseIIItranscription for generation of shRNA transcripts.cPPTCentral polypurine tract, cP

10、PT, improves transduction efficiency by facilitating nuclear import of the vectors preintegration complex in the transduced cells.hPGKHuman phosphoglycerate kinase promoter drives expression of puromycin.Puro RPuromycin resistance gene for selection of pLKO.1 plasmid in mammalian cells.sin 3LTR3 Sel

11、f-inactivating long terminal repeat.f1 orif1 bacterial origin of replication.Amp RAmpicillin resistance gene for selection of pLKO.1 plasmid in bacterial cellspUCoripUC bacterial origin of replication.5LTR5 long terminal repeat.RRERev response element.A.3 Related ProductsThe following plasmids avail

12、able from Addgene are recommended for use in conjunction with the pLKO.1 TRC-cloning vector.Plasmid (Addgene ID #)DescriptionpLKO.1 TRCcontrolNegative control vector containing non-hairpin insert.pLKO.1 scramble shRNANegative control vector containing scrambled shRNA.psPAX2Packaging plasmid for prod

13、ucing viral particles.pMD2.GEnvelope plasmid for producing viral particles.Note: pLKO.1 can also be used with packaging plasmidpCMV-dR8.2 dvprand envelope plasmidpCMV-VSVGfrom Robert Weinbergs lab. For more information, visit AddgenesMammalian RNAi Toolspage.Several other laboratories have deposited

14、 pLKO derived vectors that may also be useful for your experiment. To see these vectors, visit Addgenes website and “search for “pLKO”“.Back to TopB. Designing shRNAOligos for pLKO.1B.1 Determining the Optimal 21-mer Targets in your GeneSelection of suitable 21-mer targets in your gene is the first

15、step toward efficient gene silencing. Methods for target selection are continuously being improved. Below are suggestions for target selection.1. Use ansiRNA selection tool to determine a set of top-scoring targets for your gene. For example, the Whitehead Institute for Biomedical Research hosts ans

16、iRNA Selection Program that can be accessed after a free registration (http:/jura.wi.mit.edu/bioc/siRNAext/). If you have MacOS X, another excellent program is iRNAi, which is provided free by the company Mekentosj (A summary of guidelines for designing siRNAs with effective gene silencing is includ

17、ed here:Starting at 25nt downstream of the start codon (ATG), search for 21nt sequences that match the pattern AA(N19). If no suitable match is found, search for NAR(N17)YNN, where N is any nucleotide, R is a purine (A,G), and Y is a pyrimidine (C,U).G-Ccontent should be 36-52%.Sense 3 end should ha

18、ve low stability at least one A or T between position 15-19.Avoid targeting introns.Avoid stretches of 4 or more nucleotide repeats, especially repeated Ts because polyT is a termination signal forRNApolymeraseIII.2. To minimize degradation of off-target mRNAs, use NCBIsBLASTprogram. Select sequence

19、s that have at least 3 nucleotide mismatches to all unrelated genes.Addgene recommends that you select multiple target sequences for each gene. Some sequences will be more effective than others. In addition, demonstrating that two different shRNAs that target the same gene can produce the same pheno

20、type will alleviate concerns about off-target effects.B.2 Ordering Oligos Compatible with pLKO.1To generate oligos for cloning into pLKO.1, insert your sense and antisense sequences from step B.1 into the oligos below. Do not change the ends; these bases are important for cloning the oligos into the

21、 pLKO.1 TRC-cloning vector.Forward oligo:5 CCGG21bp senseCTCGAG21bp antisenseTTTTTG3Reverse oligo:5 AATTCAAAAA21bp senseCTCGAG21bp antisense 3For example, if the target sequence is (AA)TGCCTACGTTAAGCTATAC, the oligos would be:Forward oligo:5CCGGAATGCCTACGTTAAGCTATACCTCGAGGTATAGCTTAACGTAGGCATTTTTTTG3

22、Reverse oligo:5AATTCAAAAAAATGCCTACGTTAAGCTATACCTCGAGGTATAGCTTAACGTAGGCATT3Back to TopC. Cloning Oligos into pLKO.1The pLKO.1-TRCcloning vector contains a 1.9kb stuffer that is released upon digestion with EcoRI and AgeI.The oligos from section B contain the shRNA sequence flanked by sequences that a

23、re compatible with the sticky ends of EcoRI and AgeI. Forward and reverse oligos are annealed and ligated into the pLKO.1 vector, producing a final plasmid that expresses the shRNA of interest.C.1 Recommended MaterialsMaterialVendor and catalog #AgeINew England Biolabs (NEB) #R0552SEcoRINEB#R0101ST4

24、DNAligaseNEB#M0202SNEBbuffer 2NEB#B7002SDH5 alpha competent cellsInvitrogen #18258-012Qiaquick gel extraction kitQiagen #28704Low melting point agaroseSigma #A9414Luria Broth Agar (LB agar)American Bioanalytical: #AB01200-02000AmpicillinVWR: #7177-48-2. Use at 100 g/mL.CarbenicillinVWR: #80030-956.

25、Use at 100 g/mL.C.2 Annealing Oligos1. Resuspendoligos in ddH2O to a concentration of 20 M, then mix:5 L Forward oligo5 L Reverse oligo5 L 10xNEBbuffer 235 L ddH2O2. Incubate for 4 minutes at 95C in aPCRmachine or in a beaker of boiling water.3. If using aPCRmachine, incubate the sample at 70C for 1

26、0 minutes then slowly cool to room temperature over the period of several hours. If using a beaker of water, remove the beaker from the flame, and allow the water to cool to room temperature. This will take a few hours, but it is important for the cooling to occur slowly for the oligos to anneal.C.3

27、 Digesting pLKO.1TRCCloning Vector1. Digest pLKO.1 TRC-cloning vector with AgeI. Mix:6 g pLKO.1 TRC-cloning vector (maxiprep or miniprepDNA)5 L 10xNEBbuffer 11 LAgeIto 50 L ddH2O Incubate at 37C for 2 hours.2. Purify with Qiaquick gel extraction kit. Elute in 30 L of ddH2O.3. Digest eluate with EcoR

28、I. Mix:30 L pLKO.1 TRC-cloning vector digested with AgeI5 L 10xNEBbuffer for EcoRI1 LEcoRI14 L ddH2O Incubate at 37C for 2 hours.4. Run digestedDNAon 0.8% low melting point agarose gel until you can distinctly see 2 bands, one 7kb and one 1.9kb. Cut out the 7kb band and place in a sterile microcentr

29、ifuge tube.When visualizingDNAfragments to be used for ligation, use only long-wavelength UV light. Short wavelength UV light will increase the chance of damaging theDNA.5. Purify theDNAusing a Qiaquick gel extraction kit. Elute in 30 L of ddH2O.6. Measure theDNAconcentration.C.4 Ligating and Transf

30、orming into Bacteria1. Use your ligation method of choice. For a standard T4 ligation, mix:2 L annealed oligo from step C.2.20 ng digested pLKO.1 TRC-cloning vector from step C.3. (If you were unable to measure theDNAconcentration, use 1 L)2 L 10xNEBT4DNAligase buffer1 LNEBT4DNAligaseto 20 L ddH2O I

31、ncubate at 16C for 4-20 hours.2. Transform 2 L of ligation mix into 25 L competent DH5 alpha cells, following manufacturers protocol. Plate on LB agar plates containing 100 g/mL ampicillin or carbenicillin (an ampicillin analog).Back to TopD. Screening for InsertsYou may screen for plasmids that were successfully ligated by restriction enzyme digestion. However, once you have identified the positive clones, it is